The quest to resurrect the woolly mammoth on Earth has taken another, well, small step with the creation of the Colossal ...
The medium was refreshed after 5 hours of incubation. After two/three days T cells were incubated with RNP composed of recombinant Cas9 (IDT) and a guided RNA (gRNA TRAC: ucaggguucuggauaucugu) against ...
We sell different types of products and services to both investment professionals and individual investors. These products and services are usually sold through license agreements or subscriptions ...
Department of Computer Science, University of New Mexico, Albuquerque, New Mexico 87131, United States Center for Biomedical Engineering, University of New Mexico, Albuquerque, New Mexico 87131, ...
RNP complexes were formed by combining 20 μg equimolar mixture of tracer and gRNAs with 15 μg SpCas9 (43). We delivered RNPs with Lipofectamine CRISPRMAX Cas9 Transfection Reagent (cat no. CMAX00001, ...
with the aim to be engineered by Cas9 ribonucleoprotein (RNP) to increase their therapeutic ability. 6 The potential for CRISPR technology is significant in medicine for many diseases, which ...
Oxaliplatin-resistant cells exhibited transcriptional downregulation of caspase-10, but this had minimal effects on TRAIL sensitivity following CRISPR-Cas9 deletion of caspase-10 in parental cells.