The quest to resurrect the woolly mammoth on Earth has taken another, well, small step with the creation of the Colossal ...
This method is particularly advantageous when working with CRISPR/Cas9 RNP complexes, which can be delicate and require gentle loading conditions. By adjusting parameters such as the solvent, ...
The medium was refreshed after 5 hours of incubation. After two/three days T cells were incubated with RNP composed of recombinant Cas9 (IDT) and a guided RNA (gRNA TRAC: ucaggguucuggauaucugu) against ...
The same study [13] showed that L1TD1 localizes to high-density RNP condensates and enhances the translation ... deletion in the exon 4 of the DNMT1 gene were generated using CRISPR/Cas9 gene editing.
The Cas9 protein is the most widely used by scientists. This protein can easily be programmed to find and bind to almost any desired target sequence, simply by giving it a piece of RNA to guide it ...
We sell different types of products and services to both investment professionals and individual investors. These products and services are usually sold through license agreements or subscriptions ...
This study convincingly shows that aquaporin-mediated cell migration plays a key role in blood vessel formation during zebrafish development. In particular, the article implicates hydrostatic pressure ...
Danielle is a Senior Editor at The Scientist. She has a background in neuroscience. Her science communication experience spans journalism, scientific publishing, and science education and outreach.