Infection with Zika virus in pregnancy can lead to neurological disorders, fetal abnormalities and fetal death. Until now, how the virus manages to cross the placenta, which nurtures the developing ...

A new study led by Flinders University has found that the speed at which water flows from a tap can significantly impact the possible risk of infections spreading in hospital and aged-care settings.

It all started in 2021 with a nostalgic Kickstarter campaign by a local pair of G.I. Joe action figure collectors. Now three years later, the dramatic Roboskull spaceship on the shelves of Midwest ...

The School of Medicine is a major international centre for teaching and research, and committed to the pursuit of improved human health. We combine progressive healthcare education and patient care ...

The game footage was clearly not intended to be shown publicly, with debug programming elements visible on-screen ... announced that Grand Theft Auto 6 will come to PlayStation 5 and Xbox Series ...

American Resources Corporation (NASDAQ:AREC) ("American Resources" or the "Company"), along with its holding in ReElement Technologies Corporation ("ReElement"), a leading provider of high ...

dealing with a potential staph infection. Re-sharing a post from West Till Death MMA which claimed the UFC 312 main event might be in jeopardy on his Instagram story, McGregor dropped a six-word ...

ReElement Technologies occupies a critical position in today's supply chain, commercializing what we believe is one of only two foundational technologies capable of separating and purifying complex ...

Reverse transcription–polymerase chain reaction (RT-PCR). RNA was subjected to reverse transcription and PCR using Fcα/μR-specific primers (5′–AGTGTTACCACGAGTGAAGG–3′ and 5 ...

Six studies reported overall increases in tuberculosis case ... contributing to a comprehensive synthesis of available evidence. Key elements such as the severity of armed conflicts in each study were ...